Kuslarimiz Hakkinda Sorular ve Cevaplar

lirik guzel
8-07-08, 00:07
Benim oğluşumun ne edepsizlik yaptığını bir önceki sayfada yazmıştım.Bizimki hala tam gaz devam ederken herkesin içinde,babam demez mi:Bunun popişi kaşınıyor,zeytinyağı sürelim . :roflol: Ah Bıdık ,Ah!...Okumuş adamı da kandırdın ya oğlum,ben sana ne diyeyim!..Dua et ki ,popişine yoğun ısrarım sonucu zeytinyağı sürülmedi.:roflol:

8-07-08, 00:07
lirik güzel
Benim oğluşumun ne edepsizlik yaptığını bir önceki sayfada yazmıştım.Bizimki hala tam gaz devam ederken herkesin içinde,babam demez mi:Bunun popişi kaşınıyor,zeytinyağı sürelim . :roflol: Ah Bıdık ,Ah!...Okumuş adamı da kandırdın ya oğlum,ben sana ne diyeyim!..Dua et ki ,popişine yoğun ısrarım sonucu zeytinyağı sürülmedi.:roflol:
yok ya görmezlikten geliyorlar. ben de babama diyom çok seviyo o. bak kızına koca alalım gerek yok benim çocuğumun günahını almayın diyor kızıyo bana :roflol:traş fırçasına sürtünürken afedersiniz hayvan kendinden geçiyo artık en son utana sıkıla onu da söyledim :eek:ona da benim çocuğum öyle şey yapmaz diyo sırnaşık şeysırnaşık şeyyaf benden daha çok güveniyo hayvana :uhm::roflol:

8-07-08, 01:07
benim de erkek bi muhabbet kuşum var ..ne yalan söyleyim tek azgın benim muhabbet kuşum zannederdim .:roflol:meğer hepsinde varmış bu durum .
ben buna bebekken aldığımda canı sıkılmasın arada oynasın die kafesinin üstüne küçük bi oyuncak ayı taktım .. zamanla onunla oyun oynamaya başladı sonrada zevcesi yaptı ..valla şimdi bütün gün tepesinde yıkamak için almak istesem bile bana çok kızıyor..Kötü Kazenaşkım aşkııııım die bağırıyo .. ya bunlar ne velet ya gerçekten anlıyomu ne..naniknanik
ama onu çoook seviyoz ya bitanem benim..
işte bizim durumda böle yani bu yönden pek bi sıkıntımız olmadı valla .. kendi kendine çözdü sorununu ..erkek kuşları olanlara tavsiye ederim ..

december canım valla senin yapacan pek bişi yok gibi güzelim ya.. bence onu kuşcuya götür 1 -2 hafta misafir olsun orda ,belki bu dönemi geçicidır..
geçmediğini fırçadan anlarsınız zaten :eek:.. o zaman bi erkek almanızdan başka çare görünmüo gibi...

8-07-08, 01:07
kuşun ne durumda hala aynımı..?

8-07-08, 18:07
kıç sallamayı bıraktı ama evin içinde hayvan deli danalar gibi oldu.
bağırıp çağırıyor durduk yere ciyak ciyak. ötmek değil ama catcatcat diye ayy hele de başkası konuşuyo olsun kaynana gibi oldu dakikalarca susmadan catcatcatcatcatcatcat yapıyo ordan oraya uçuyo. sürekli böyle şikayet eder gibi yırtınıp duruyo. diyom bizimkilere bakın bu "canıma tak etti evden kaçacam" demek diyom annamıyolar. sinir yaptı hayvancağız :KK43:( babama sırnaşıyo gene hala :S

30-07-08, 10:07
Kızlar ağustos ayında bir haftalık şehir dışına çıkmayı düşünüyoruz.
muhabbet kuşumuza iyi bakabileceğini düşündüğümüz kişiler var,onların da kuşu var.
fakat biz kuşu biraz bebek gibi yetiştirdik.
mesela topları var, toplarını halıya çıkarırız akşama kadar oynar, ya da geceleri benim yatağımın dibine kafesini koyarım, öyle uyuruz.
endişeleniyorum başka birinde bir hafta problemsiz kalabilir mi?
onu götürmem zor çünkü 1 hafta için yollara,sıcağa,ortam değişikliğine dayanması zor olur.

30-07-08, 12:07
Merhaba, elbet ki kimse sizin bakabildiğiniz gibi bakamayacak.

Çok seven biride olsa istesede sizin gibi bakamayacak. Çünkü kuş yabancı bir ortam görecek tanımadığı insanlar olacak. Biraz afallayacak yani.

Siz hayvanları çok seven birine bırakın zaten alışma süreci bitene kadar siz dönmüş olacaksınız.

31-07-08, 15:07
arkadaşlar bn muhabbet kuşumu değiştirdim 45 günlük erkek isim ne koyayım sizce

31-07-08, 15:07
bende dün yavru ingiliz jumbo aldım öyle güzelki daha önce kaçırmıştım iki tane dün aldım bu gün elimde duruyo beni dinliyo tabi ben bir yıldır sürekli muhabbet kuşu cinslerini ve bakımını araştırıyorum harika kuşlar eminim kuşum on güne kalmaz iyice alışır kaynaşır bize:) kuşum erkek ilk başlarda oyuncak koymucakmışsın aynada dahil sonra alışınca koyabirmişsin eğitim için bebek olması şart bebişimin rengi mavi gri

2-08-08, 02:08
cok korkuyorum acıkcası basına bisi gelir, biz olmadan duramaz diye.
geçen sene sırf bu yüzden tatile gitmedik. artık bu sene çıkalım diyoruz ama inşallah bir sorun yaşamayız.

3-08-08, 00:08
arkadaşlar bn muhabbet kuşumu değiştirdim 45 günlük erkek isim ne koyayım sizce

nasıl değiştirdiniz?
bana alınan evcil hayvanın geri verilmesi, değiştirilmesi çok vicdansızca geliyorda..:kızgın:

10-09-08, 17:09
valla böyle muhabbet kuşu duymamıştım yazık kuşa benimde dişi gökkuşağı papağanım vardı eşi yoktu kuş yumurtlamaya başladı hergün bir yumurta vterinere sorduk çiftleşmek istiyomuş yumurtalarda döl yokmuş o zamanlar papağan ların fiyatı yüksekti alamadık yazık kuş çiftleşemeden yumurtlayarak öldü çok üzüldüm

26-09-08, 22:09
Arkadaşlar benimde biri diş diğeri erkek olmak üzere 2 tane muhabbet kuşum war.erkek olan 4 dişide 5.5 aylikti sanirim..walla ilk aldiğimizda kafeslerine salincak yerleştirdik.birak o salincağa çikmayi çitlari bile çikmiyordu.şimdi felaket derecede bicir bicir ötüyorlar.televizyonun yanina koydum.erkek olan sese aşiri duyarli deli gibi ötüyor.en güzelide dişi ondan büyük olduğu için onu besliyor .ağzina kusuyor yediği yemleri .hi salincak demiştim şimdi salincaği tepesinden inmiyorlar onun üstünde uyuyorlar bazen .çok şekerler ya ele aliştirmaya başladik dişi çok hirçin ama erkek uysallaşiyor zamanla.bide dişi olan çok pis isiriyor.elimize alamiyoruz parmak falanda çözüm olmadi walla napcaz bilmiyorummm.

29-09-08, 10:09
yaa konu açmaya çalışıyorum açamıyorum burdan devam edim bari.bende 3 gün oldu muhabbet jkuşu alalaı ama pek ötmüyo arada bir işte:)acaba alışma evresimi ki ortama bizlere falan.sizlerdede böle oldumu sinirim bozuluyo bişler yazın kızlar

31-10-08, 18:10
Kızlar 2 ay önce yavru olarak aldığım muhabbbet kuşum yaklaşık 1 haftadır çatur çutur şiddetle kaşınıyordu.Bugün bir veterinere tlfn açtım ve bana avidust diye bir toz önerdi.Kuşa yalasa bile bir zararı olmayacağını kanatlarının altına kafese ve sırt bölgesine dökmemi söyledi.Azönce kafesi güzelce kaynar sularla dezenfekte ettim ve o tozdan kafesin kuşumun ulaşamayacağı bölümlerine az az döktüm.Kuşumunda kanat altlarına ve sırtına serpiştirdim bu tozdan garibim nasıl koktu elime alıp kanatlarını açmaya çalışınca senağlama neyse şimdi aynasıyla oyun oynuyor umarım bişey olmaz :KK43: Başınıza böyle bişey geldimi kızlar mubişinize böcek ilacı dökmek zorunda kaldınızmı zehirlenmez dimi yaa ...

31-10-08, 18:10
yok canım kalmaz.
benim kuşumunda başına geldi.biz de dökmüştük o tozdan.
yalnız ne kadar korkarsa korksun sen düzenli ilaçla onu.
birde vitamin al suyuna kat..

31-10-08, 18:10
Geçmiş olsun canım,mantar tarzı bişey olmasın sakın?Ben 12 yıl muhabbet kuşu besledim ama hiç böyle bir şeyle karşılaşmadım...

31-10-08, 18:10
KIzlar teşekkür ederim yaa hemen gördünüz imdadımı a.s.Bİde saruböceq başınıza gelmiş bize gelmemiştir dimi bu bitlerden yaaa :KK43:(( Yani ben çocuklarımda ve kendimde bir kaşıntı farketmedim henüz yani acaba bunlar hayvan bitimidir nedir:Allahım nerden geldi bu kaşıntı minnoşuma yaaa :KK43:
Yani diyosunki birkaç gün bu tozu serp kuşa öylemi ?? Kaç günde geçer acaba ay nasıl panik oldum beee üf..

31-10-08, 18:10
canım şimdi ne kadar süreyle kuşa dökülüyordu inan hatırlamıyorum.
ama kuşcu ne dediyse doğru o ölçekle sen dök ona.
biz yapmıştık geçmişti.
damlacım bu arada kuşlarda mantar sadece ayaklarında oluyor.vucutlarında değil.
ama dediğim gibi vitamin de al sen ona sıvı vitaminlerden var.
suyuna katıyorsun.
kaşınmakdan harap oluyor yavrum o vitaminle ayakta duruyor

31-10-08, 19:10
Teşekkür ederim cevaplarınız için arkadaşlar kaydirigubbakcemile5 Umarım biran önce iyi olur boncuğum bende size fotolarını yollarım :)

12-11-08, 19:11
ayy valla bizimki taklit etmiyor da atıyorum elektrik süpürgesi sesi duyduğunda bıçırdıyor..
ayrıca gökhan özen tarkan kenan doğulu gibi bilimum hareketli pop şarkıcılarını duysun sağa sola sallanıyor..
Benim Eguş ta iki gündür özellikle " eye of tiger" şarkısını pc de açtım mı deliriyor,kafa sallamalar,hızlı hızlı sallanmalar.kaydirigubbakcemile3:lepi:
Gülmekten ölüyorum onun hareketlerini izlerken:roflol:
Rocky nin kuş hali mübarek..

14-11-08, 16:11
Benim kuşum da müzik çalmadan da oynar
sırf dikkat çekmek için bulunduğu yerde ileri geri hızlı hızlı
gidip gidip gelir. Kafasını aşağı yukarı sallar oyun yapar herşeyi
ıslık çalar ahh bir de konuşabilse...

15-11-08, 09:11
kızlar benimde var bir tane muhabbet kuşum.Adını umut koydum.Bana her daim umutlu olmam gerektiğini hatırlatsında bir bebek sahibi olmak için umutsuzluğa kapılmayayım diye.Ama çok hırçın.Hiç sevdirmiyor kendini.Sürekli kaçma kovalamaca oynuyoruz.İlk aldığım hafta kedi saldırmıştı buna herhalde onun etkisiyle böyle oldu.Biz daha uyanmadan ötmeye başlar uyandırır bizi.Bir de tv açtıkmı susturabilene aşkolsun.Yakında maç spikerliğine başlayacak.Eşim maç izlerken sürekli kıpır kıpır dolanır cik cik öter.O da maçın havasına giriyor zavallı.Ama ona dokunamamak çok üzüyor beni.Ben sevgimi dokunarak belli eden bir insanım.

2-12-08, 16:12
merhaba arkadaşlar,
bu gün muhabbet kuşu aldım mavi renkte ve cinsi erkek ama bir isim bulamadım bana yardımcı olurmusunuz şöyle farklı ama janjan lı bişey olsun istiyorum:1rolleyes:

2-12-08, 17:12
arkadaşlar fikir verecek yokmu

5-12-08, 14:12
janjan koyabilirsin hem farklı hem janjanlı :roflol: sağlıklı ömürler diliyorum.

5-12-08, 17:12
merhaba arkadaşlar,
bu gün muhabbet kuşu aldım mavi renkte ve cinsi erkek ama bir isim bulamadım bana yardımcı olurmusunuz şöyle farklı ama janjan lı bişey olsun istiyorum:1rolleyes:
Canım ben sana bir öneride bulunabilirim istersen. Benim minik kuuşum da senin tarifine uyuyor. Mavi ve erkek. Adı da Cingöz. Senin kuşunun da isim annesi olabilirim istersen kaydirigubbakcemile3 Adaş olsun kuşlarımız kaydirigubbakcemile5

5-12-08, 17:12
2 yaşında bir erkek muhabbet kuşu anası olaraktan tavsiyelerim,yerimseniben

vs vs vs...

bu arada benim kuşumun adı Ege Cicikuş.Şeniz
Biz kısaca Eguş diyoruz,oda alıştı.
Eguş diyo kendine...

5-12-08, 17:12
çiko koyabılırsın adını bence cok tatlı bır ısım.. Şeniz

6-12-08, 14:12
teşekkür ederim herkese ismi çapkın oldu bakalım allah sonumuzu hayır etsin naparsak artık bu çapkınla

6-12-08, 14:12
merhaba;muhabbet kuşları genelde ş,ç,c,k harflerini çok güzel algılayabiliyorlar.buna biraz dikkat etmek lazım,muhabbet deyip geçmeyin eğitimi önemlidr.benim vardı adı paşaydı.çok güzel söylüyordu ismini,erkeğe de yakışıyordu.sevgiler.

6-12-08, 17:12
Arkadaşlar 2 hafta önce kuş aldık.İlk 1-2 gün durgundu bizde kafese alışamadı, bize alışmadı ondandır diye düşünüyorduk.
Sonra düzeldi oynamaya başladı bizimle.Daha yavru uçamıyo bile.Yeni yeni ötmeye başlıyordu.
3 gündür çok durgundu.İlk başta önemli bir şey olduğunu anlayamadık.Dün akşam o kadar kötüydü ki.Sesi bile çıkmıyo artık:çok üzgünüm:
İshal zaten,tüylerini kabartıyo koyduğumuz yerde duruyo öyle.Gözleri sürekli kapalı.Yürümeye çalışıyo resmen sallanıyo, denge kuramıyo.
Nöbetçi veteriner bulur muyum diye çok aradım ama bulamadım.
Bu sabah götürdüm ileri derecede ishal dedi.Kendini bilmiyo hastalıktan dedi.
Muhtemelen aldığınız yerden kapmış dedi.Ölür mü dedim, çok sıkıntılı dedi.senağlama
Vitaform verdi.İçirmeye başladım.Ama yemek yemiyo öyle duruyo garibim kafesin içinde.
Az önce kafeste tırmanmaya çalıştı bi yerlere hareketlendi, sevindim kendine geliyo diye ama yok.
Yine öyle bi yerde sabit duruyo gözlerini açamıyo.senağlama
Ya ölemsin istiyorum az bi zaman oldu bize geleli ama çok alıştık biz.
Haşlanmış patates falan diyorlar.Sizin bildiğiniz bir şey var mı yapabileceğim?Yoksa ilaç sadece yeter mi?

6-12-08, 17:12
İshal kuşlar da maalesef çok ciddi boyutlarda önem taşır genel de sonu üzücüdür ama başlarında ise kurtulma şansı vardır.

Dilerim atlatır yavrunuz çok üzüldüm geçmiş olsun.

6-12-08, 18:12
Sanırım başlarda değil.Doktor ilerlemiş dedi.
Belki bi mucize olur da iyileşir bebeğim.:Saruboceq:
Hareket etmeye çalışıyo ama hali yok.Allah'ım yardım etsin.

6-12-08, 18:12
iste ben evcil hayvanlara bundan sicak bakmiyorum,nice kuslarim baliklarim ve kedim öldü:KK43:((((
ishal cok fena kuslar icin canim,ilacini düzenli ver ve daha cok ilgilen onlar bunu anliyorlar...
insallah iyilesir minik kusun:KK43:((

6-12-08, 20:12
Benim tavsiyem ise suyunun içinde yarım "bebe" aspirini eritin. Hani suyu içtiği kısım var ya tam oraya yarım bebe aspirinini koyun biraz elinizle ezin erisin. Ordan içsin. Hatta durumu ağır ise o suya elinizi daldırıp damlayı agzından iceri dökebilirsiniz. Ben Cingözüm hasta olduğu zaman hep asprinli su veririm. Dediğim gibi eğer çok halsiz bitkinse elimle agzına damlatırım suyu. Umarım sizin minik kuşunuz da bir an evvel sağlığına kavuşur. İyi haberlerinizi bekliyoruz :Saruboceq:

6-12-08, 22:12
Kuşum öldü.senağlama
İlacını içirmek üzereydik ki elimiz de can çekişe çekişe öldü.senağlama:çok üzgünüm:

6-12-08, 22:12
Kuşum öldü.senağlama
İlacını içirmek üzereydik ki elimiz de can çekişe çekişe öldü.senağlama:çok üzgünüm:
çok üzüldüm.....senağlama
benim de iki tane muhabbet kuşum var.
alışıyor insan onların varlığına.:1hug:
ama üzülme canım,a.s. yine al seviyorsan.
hemde 1 erkek, 1 dişi al.
benim 2 kızım da onları çok seviyor.Şeniz
sende böyle severken,:nazar: mutlu olacaklardır seninle.

6-12-08, 22:12
Kuşum öldü.senağlama
İlacını içirmek üzereydik ki elimiz de can çekişe çekişe öldü.senağlama:çok üzgünüm:
çok üzüldüm başınız sağolsun

6-12-08, 23:12
benimde kuşum 1 hafta önce ishalden öldü ve aynı senin tarif ettiğin şekilde :çok üzgünüm::çok üzgünüm:senağlama çok ağladım,deli gibi konuşan bir kuştu bembeyaz oğlumdu o benim. onu çok özlüyorum.sende üzülme olur mu çünkü geri gelmiyorlar:1no2::çok üzgünüm:

6-12-08, 23:12
Kuşum öldü.senağlama
İlacını içirmek üzereydik ki elimiz de can çekişe çekişe öldü.senağlama:çok üzgünüm:
Ah ah neden bu konuya geri döndüm ki...

İşte yıkıldım okuyunca hemde son cümleniz beni yedi bitirdi.

Çok üzgünüm o yavrucak için hem de çok.

Çok üzgünüm...

7-12-08, 07:12
Çok teşekkür ederim arkadaşlar.
O halde görmek öyle kötüydü ki.Sürekli kendimi suçluyorum bakamadım mı acaba diye.
Ama biz evde bütün vaktimizi ona ayırıyorduk.
Yavru olduğu için kafesinden yemini yiyemiyordu bile.
Çok sevdim ben onusenağlama
Akşamdan beri çok kötüyüm.
Gece öldükten sonra bi süre gömemedik bile.Sevdik öptük.
Sonra çıkıp mecburen gömdük.
desteğiniz için yeniden teşekkür ederim arkadaşlar.

7-12-08, 09:12
canım başın sağolsun..
bende bekarken çok kuş baktım.hep uzun yıllar yaşadılar bizimle.b tanesi 6 yıl bi tanesi 8 yıl yaşadı.ölünce gerçekten çok üzülüyorsun.
ama zamanla gidiyor her acının gittiği gibi..
sana tavsiyem yeni bir kuş al kendine..
işte insan bağlanıyor da..alınca.
şimdi bizde 1.5 yıldır var..maşallah:nazar:

7-12-08, 10:12
of şirinem,:çok üzgünüm:
çok üzüldüm ben de. senle alakası yoktur, çok hassas oluyor minikler.
biz de çok besledik kuş, ölümlerine çok üzüldüğümüz için ilk kuşlar dışında almadık.
sonrakileri hep başkaları verdi, ya bakamadığından ya da dışardan evin içine kaçanlardan.
artık hayvan almıyorum. acısı çok fazla oluyor.

2-01-09, 12:01

arkadaşlar dün eşim bana bitane gök mavisi arada beyazlarıda var çok şirin,
bir hollanda tipi muhabbet kuşu almış,
ama buzamana kadar hiç kuş bakmadım kii,
yani dün biraz ilgilendim ama korkuyor hemen kafeste uçuşuyor,
hiç ötmedi dün,bugün biraz müzik açtım baktım nasıl ötüyor,
acaba müzikten anlıyormukaydirigubbakcemile3
olabilir ama değilmi?
ilk haftalar ilgilenmeyin pek fazla demiş satan adam eve alışsın demiş,
öylemi aca???bir bilgisi olan varmı???

5-01-09, 10:01
merhaba arkadaşlar bizimde dün aramıza katılan şirin bir muhabbet kuşumuz oldu çok sevimli daha 1 aylık yavru sadece su içiyor yem yemiyor kızımın yemek derdiyle uğraşırken bide kuşun yemek yeme derdiyle uğraşıyorum inşallah bir an önce yemeyi öğrenir aç kalıyo diye çok üzülüyorum
arkadaşlar bide isim sorunumuz var fikir verirseniz sevinirim


5-01-09, 11:01
Yemeyi öğrenmek gibi bir durum olmaz kuşlar doğdukları an beslenmeye başlarlar.

Ya yemi beğenmedi ya yem çok büyükse şuan yavru olduğu için kavrayamıyordur.

Bunları kontrol edin yem yememeye devam ederse rahatsızlığı olabilir veterinere gösterin.

5-01-09, 13:01

yaa bizim kuş yeni olduğu içinmi,
hiç elimize gelmiyor?
heryere konuyor odada hatta lcdnn üstüne bile ama elimize konmuyor,
eşim zorla yemle kandırarark eline bi kere aldı,
odaa çok uğraştı
bir bilgisi olan varsaa yardımcı olabilirmi bana acep:uhm:

5-01-09, 14:01

yaa bizim kuş yeni olduğu içinmi,
hiç elimize gelmiyor?
heryere konuyor odada hatta lcdnn üstüne bile ama elimize konmuyor,
eşim zorla yemle kandırarark eline bi kere aldı,
odaa çok uğraştı
bir bilgisi olan varsaa yardımcı olabilirmi bana acep:uhm:

Ne kadar süredir sizinle, eğer çok yeniyse zorlamayın o size gelecektir.

Sizden bir kez ürkerse bir daha size yanaşmaz, kuşlar çok ürkektir.

Eğer uzun süredir sizde ise mutlaka bişey onu sizden korkutmuş ve uzaklaştırmıştır.

ama dediğim gibi kesinlikle zorlamayın bir gün o size gelecektir.

Kimi kuşlar hemen yanaştığı gibi kimi kuşlar aylar sonra alışabilir.

İnsan gibi hepsinin karakteri farklıdır.

5-01-09, 15:01

Ne kadar süredir sizinle, eğer çok yeniyse zorlamayın o size gelecektir.

Sizden bir kez ürkerse bir daha size yanaşmaz, kuşlar çok ürkektir.

Eğer uzun süredir sizde ise mutlaka bişey onu sizden korkutmuş ve uzaklaştırmıştır.

ama dediğim gibi kesinlikle zorlamayın bir gün o size gelecektir.

Kimi kuşlar hemen yanaştığı gibi kimi kuşlar aylar sonra alışabilir.

İnsan gibi hepsinin karakteri farklıdır.

yaa snaırım kii 4 gündür bizde,
yani elime almayı deniyorum ama gelmiyor,
demekki zorlamayacağız,gerçekten çok ürkek,
kafesi bile taşısam içerde uçuşuyor çok korkuyor,
nasıl yaklaşsam acaba:uhm:
neyse onun gelmesni bekleyeceğim artık bakalım
açıklaman için sağol canımma.s.