Şu anda arşiv sayfalarında bulunmaktasınız. Konunun orjinali için tıklayınız:

Kuslarimiz Hakkinda Sorular ve Cevaplar


decemBer
3-06-08, 03:06
emire26
teşekkür ederim arkadaşlar. galiba bizim ki kabız yapamıyor gibi geliyor bize.ishal degil ondan eminim.ötüyor kafesinde uçuyorda.bügün bizim evde 5 günü hala kafesten cıkarmadık akşam cıkarsak diyoruz bakalım
ayyy kabız o hayvan inşallah ölmemiştirrrr acilen bi kuşçuya sorun ben öyle bi tane kaybettim :KK43:( suyuna azıcık limon damlatmak gerekiyor sadece:KK43:

decemBer
3-06-08, 03:06
bayanlar nasıl yazılır kimden yardım alınır bu konuda bilmiyorum, utanıyorum da. siz bana yardım edersiniz diye düşündüm..kafamçokkarıştı

bizde 1,5 yaşında yerli bi dişi kuş var. ama evin çocuğu gibidir, iki kelime konuşamasa da kızar bağırır çağırır derdini anlatır. resmen insan gibi neyse.

şimdi bununla en çok babam ilgilendi hep. ilk başlarda kafese girmediği için ben ve annem elimizde tutup koyuyoduk kafese o yüzden bizimle babam kadar haşır neşir değil.

herneyse, babamla öpücük atarlarken bu hayvan son 2-3 aydır poposunu havaya dikmeye başladı :S ay çok utanıyorum. resmen böyle kasılıp kalıyor, poposunu havaya dikiyor. böyle nefes alıyo gibi oluyor... sanırım hayvanın çiftleşme vakti geldi de erkeklik hormonunun kokusunu alınca şey mi oldu nedir :s

hani erkek köpekler kadınların bacaklarına şey yaparlar ya, bu da aynı babama gidiyo hop diye totoyu dikiyo bi tuhaf. bize hiç öle yapmıyo..

şimdi bi de adet edindi banyodaki babamın traş fırçasının üstüne konuyo popsunu sürtünüyo :KK43:(( ama bıraksam saatlerce kalcak orda , zorla çekip alıyoz falan.


çiftleşmek istiyo galiba ama biz ikinciyi almak istemiyoruz. komşununkine bakalım dedik, bizimki hayvanın üstüne atladı ama komşunun oğlan beğenmedi S: erkeğin beğenmesi gerekiyomuş olmadı yani :S

bu muhabbet kuşlarına da kediler gibi ilaç verilebiliyomu durulabilmesi için bilginiz var mı?

senelerdir muhabbet kuşu besledik, genelde hep dişi oldu. ilk defa böyle bir şeye rast geldim. erkek kuşlar yapıyodu yine ama dişiye ilk defa şahit oldum :s

dediğim gibi bi ilaç bilen varsa tavsiye edebilir mi? kuşçuya gidip sormaya utanıyoruz da...:eek:

:S

EU1
3-06-08, 05:06
: :roflol::roflol::roflol:
ahahahaa
senin kuş babana aşık olmuş kızz.
Bizimde dişimiz vardı kocasıda vardı ama kocası onu begenmiyodu:dilcikar:
oda kuduruyodu erkegini köşeye sıkıştırıyoduŞeniz
ama erkekten dayak yiyodu :eek:klava::asigim:
Sana tavsiyem kuşunuzdan daha iri bi damızlık erkek almanız ve birbirlerine alışması için bi süre salmanız...
süre sonunda ciftlemeye başlarlarsa vitaminlerini vermeyide unutma
bunun ne yazıkki başka cozumu yok:1no2:
sana kolay gelsin canımmm yardıma ihtiyacın olursa ben buralardayım jeyyar

smhsmh
3-06-08, 05:06
bende ilk defa duyuyorum
vay senin kuşa bak hele
netten bi araştır tatlım bakalım
erkekmi kuş alsaydınız ne
jeyyar

minikiz
3-06-08, 06:06
:roflol::roflol::roflol::roflol: aha azgın kuş sendromu.kolay gelsin arkadaşım.bilgim yok ama bir veterinerden falan yardım alın.ya da nette araştır aynı şeyi yaşayan vardır belki.cinsel sorunları olan kuş ilk kez duydumsırnaşık şeysırnaşık şeysırnaşık şey

nevbahar
3-06-08, 06:06
Merhaba,

Dişi olduğuna göre gagası beyazdır. Şuan gagasına bakarmısınız eğer ki kızarıklık varsa kırmızıya yakın bir renge dönmüş ise kızgınlık dönemine girmiştir. Genelde ortalama 1 hafta sürer. Bu dönemde yanına erkek gelirse kabul eder. Ama bu dönem dışında erkek kuş gelirse yanına kabul etmez ve dövebilira.s.

decemBer
3-06-08, 14:06
yani öle suyuna katabileceğimiz bir ilaç yok yani... napcaz ya..
anneme diyorum bak günaha giriyoruz yazık hayvana bi erkek alalım diye.
istemiyo çünkü daha önce 2 kuşumuz vardı çiftleştilerdi ama çok pislettilerdi evi, bi de o yumurtalam zamanı çok kötü kokuyo kafes. annemi ikna edemiyorum ikinciye yani.

nevbahar şimdi bunun yaklaşık 1 ay kadar öncesine kadar gagası kahverengiydi. o kahverengilik kabuk gibi kalktı şimdi burnu krem rengi gibi. kızıllık yok hayır...

EU1
3-06-08, 14:06
¤ decemBer ¤
yani öle suyuna katabileceğimiz bir ilaç yok yani... napcaz ya..
anneme diyorum bak günaha giriyoruz yazık hayvana bi erkek alalım diye.
istemiyo çünkü daha önce 2 kuşumuz vardı çiftleştilerdi ama çok pislettilerdi evi, bi de o yumurtalam zamanı çok kötü kokuyo kafes. annemi ikna edemiyorum ikinciye yani.

nevbahar şimdi bunun yaklaşık 1 ay kadar öncesine kadar gagası kahverengiydi. o kahverengilik kabuk gibi kalktı şimdi burnu krem rengi gibi. kızıllık yok hayır...

ne yazikki senin kuş babanın fırcayla idare edecek.Şeniz

lirik guzel
3-06-08, 18:06
Aynı dertten ben de muzdaribim.Benim de oğluşum henüz 4 aylık ama yem kutusunun üstünden inmiyor.Utanıyorum gelen giden oldukça.Misafir geldi geçenlerde.''Ayyy,ayağı şıkıştı.Kurtar ,kurtar hayvancağızı.'' diyor. Ben de ne yapıcağımı şaşırdım.Dişi de almayacağız.Bilmiyorum artık ,belki buradan bir şeyler öğreniriz.a.s.

decemBer
3-06-08, 21:06
lirik güzel
Aynı dertten ben de muzdaribim.Benim de oğluşum henüz 4 aylık ama yem kutusunun üstünden inmiyor.Utanıyorum gelen giden oldukça.Misafir geldi geçenlerde.''Ayyy,ayağı şıkıştı.Kurtar ,kurtar hayvancağızı.'' diyor. Ben de ne yapıcağımı şaşırdım.Dişi de almayacağız.Bilmiyorum artık ,belki buradan bir şeyler öğreniriz.a.s.

hheheh erkek kuş zaten çok çılgın oluyor. halamların vardı zilin tepesine çıkıp....:roflol:
zil şangır şangır ötmeye başladığında "hüsnü iş başında" derlerdi :roflol::roflol:

erkek normal de dişi.. o da bize denk geldi..:bbo:

EU1
3-06-08, 21:06
¤ decemBer ¤

hheheh erkek kuş zaten çok çılgın oluyor. halamların vardı zilin tepesine çıkıp....:roflol:
zil şangır şangır ötmeye başladığında "hüsnü iş başında" derlerdi :roflol::roflol:

erkek normal de dişi.. o da bize denk geldi..:bbo:
kızlar bizim ogluş ta yemliginin ayaklık yerinde tık tık sesler cıkarıp kafa şişiriyordu demek bu yuzden di heeee....:teselli:

decemBer
14-06-08, 09:06
kafesi ayırsanız iyi olur herhalde.. çünkü erkekler daha erken kızışıyor bildiğim kadarıyla.
belki de sırf oyundur ama sanmam. çünkü benim dişi kuş böyle yapmaya 1.5 yaşında başladı, akrabamızın kuşu erkekti 5inci ayında zilin tepesindeydi :S bir kaç ay sonra bıraktı ama.

fulyaksk
14-06-08, 19:06
Teşekkür ederim hepinize şükür iyileşti.Dengesi kayboluodu uçarken şimdi o da düzldi sanırım kuşuma nazar değdi bnm :KK43: bıdır bıdır konuşur hep birileri geldiinde herkes te ne sevimli falan der.Ama şu sıralar başımızdan dert eksik olmuo maalesef :KK43:
5 gün önce hastalandı ishal olmş apar topar veterinere koştuk yine antibiyotik tedavisi falan verdi vitaminler falan.Nasıl kötüydü anlatamam sürekli uyuodu hiç konuşmuodu bi çıkarıım dışarı bakalım napck dedk bi çıktı uçmaya çalıştı ve gitti duvara tosladı :KK43:
Sora kanadında doku zedelenmesi olmş veterinere kaç kere gittigimizi hatırlamıorm.. Nazara geldi yaa bn onu çok seviorm ona bişi olursa blmiorm nolurum artık :KK43:(
Şu an ii keyfi yerinde iileşio sanırım kanadını da gerdirio filan sorun yok galiba. Bn dua ediorm hep sağlığını kaybetmesn die siz de dua edin nolur..

nemida
17-06-08, 12:06
tatlım benim ya resmen nazara gelmiş dediğin çok doğru dualarım seninle, inşallah kuşun hemen iyileşir. Kafesten çıkarma bir süre..
a.s.

tuba_ceren
18-06-08, 12:06
gecer diye düşünüyorum ama veterinere götürmekte yarar var.

fulyaksk
19-06-08, 10:06
geçti şükür iyi tamamen şu an konuşuo,uçabiliyor..Teşekkür ederim destekleriniz için. Size öpücükler yolluo hatta :KK66:

Princess
23-06-08, 17:06
ya aynı dert bizde de var..
benim de erkek kuş aynı şekilde.
yanına dişi almak da istemiyoruz bakamayız çünkü.
nasıl sakinleşir ki bunlar?

prensesa
23-06-08, 18:06
bendede erkek kuş var kuşcu bır hafta kalsın begensın bıtane dişi dedi :roflol:Şeniz
benım mavıs bıraz sosyetık her mamayı yemezz :dilcikar:yazın balkona cıkarmassan kuser :dilcikar: hayatta sevmedıgı ınsanı konusturmazz carcar öter:dilcikar:
nası beğenıcek bende anlamadımmŞeniz:1closedeyes::dilcikar:

Princess
24-06-08, 05:06
Kızlar biraz endişeliyim açıkcası.
muhabbet kuşum 1 yaşında ve erkek. bugünlerde tüy dökmeye başlamıştı ve biraz sinirliydi.
ben de az önce onu elime aldım biraz sevdim.
ama kuyruğunun alt kısmında,yani göbeğinin alt kısmında bir şişlik var.
onun ne olduğunu anlamak için biraz dokundum,yumuşar belki diye.
sonra kafese bıraktığımda garip garip kanatlarını açıp kapattı.
bunu bir süre tekrarladı sonra ben telaşla kafesi alıp oda değiştirdim.
o da bıraktı.
şimdi yem yiyor.
o şişlik ne olabilir ve bu kanatlarını açıp kapatması neye işaret acaba?

prensesa
24-06-08, 06:06
tüy dökumu ıcın ılaclar var suya katılan stresemı gırdı acaba :sm_confused:bızımkıde öyleydı bır ara sureklı uyuyo tüy döküyüdü..iyleşir inş canım üzüldüm

nevbahar
24-06-08, 07:06
Şimdi tam olarak yeri neresi acaba.

Kuyruğun al kısmında yağ dolu biz torbaları olur onların. Hani kuşlar tüylerini tek tek tarar ya, bizler faketmeyiz ama önce oradan gagasına yağ alır ve tüylerini temizler. Belki o yağ torbasına denk gelmişsinizdir. Ama farklı bir yerde ise götürün içiniz rahatlasın.

Tüy dökme mevsimseldir benim Fıstığımda az az dökmeye başladı. Bunun dışında korkulacak bir durum olduğunu sanmıyorum:teselli:

Princess
24-06-08, 17:06
şey göbeğinin biraz altı,
böyle kocaman bi göbeği var :) onun kuyruğa doğru olan kısmında bi şişlik var.

bluish
2-07-08, 22:07
Vay kıza bak sen yaa:1shok:
Ulen Çaça (benim kız) sakın he sakın sen de böyle bişey yapmayasakkelime

marchandize
3-07-08, 12:07
şişlik yağ bezesidir.eger avucunuza aldııgınızda sız ellemeden gorunuyorsa dırek veterınere goturun fakat elınızle hıssedıyorsanız bı problem yok dıye dusunmekteyım..
benım kusumda suan tuy dokuyor mevsımsel bısey .suyuna vıtamın koymayı ıhmal etmeyın .dal darılarını eksık etmeyın mubısınıze sevgıler:KK70:

marchandize
4-07-08, 06:07
kusunu bı kuscuya gotur...ordakı kafese koy eşini kendi secsın.yakınlastıgı eşi alırsın yuvalıkta alırsın.:))))))sora gelsın mınık mınık yumurtalarrr hehehe:)

decemBer
4-07-08, 18:07
yav eş seçme problemi yok her erkek kuşun tepesine biniyo ahlaksızzzzzzzzz
ama annem razı değil ikinci kuşa pis olur diye günaha giriyoz ya hayvana eziyet ediyoz :KK43:((( offfffff

marchandize
5-07-08, 12:07
okadarda pis olmuyor ya gün aşırı temızlıycen iştee :KK43:

Princess
5-07-08, 22:07
çok teşekkür ederim ben de bir veterinerle görüştüm o şişlik yağ bezesiymiş dediğiniz gibi.
elime aldığımda zaten elime geliyor sadece,yoksa dışarıdan gözükecek gibi bir şey değil.
dal darılarını da pek seviyor..
teşekkür ederim sevgiler bizden :)

lirik guzel
8-07-08, 00:07
Benim oğluşumun ne edepsizlik yaptığını bir önceki sayfada yazmıştım.Bizimki hala tam gaz devam ederken herkesin içinde,babam demez mi:Bunun popişi kaşınıyor,zeytinyağı sürelim . :roflol: Ah Bıdık ,Ah!...Okumuş adamı da kandırdın ya oğlum,ben sana ne diyeyim!..Dua et ki ,popişine yoğun ısrarım sonucu zeytinyağı sürülmedi.:roflol:

decemBer
8-07-08, 00:07
lirik güzel
Benim oğluşumun ne edepsizlik yaptığını bir önceki sayfada yazmıştım.Bizimki hala tam gaz devam ederken herkesin içinde,babam demez mi:Bunun popişi kaşınıyor,zeytinyağı sürelim . :roflol: Ah Bıdık ,Ah!...Okumuş adamı da kandırdın ya oğlum,ben sana ne diyeyim!..Dua et ki ,popişine yoğun ısrarım sonucu zeytinyağı sürülmedi.:roflol:
yok ya görmezlikten geliyorlar. ben de babama diyom çok seviyo o. bak kızına koca alalım gerek yok benim çocuğumun günahını almayın diyor kızıyo bana :roflol:traş fırçasına sürtünürken afedersiniz hayvan kendinden geçiyo artık en son utana sıkıla onu da söyledim :eek:ona da benim çocuğum öyle şey yapmaz diyo sırnaşık şeysırnaşık şeyyaf benden daha çok güveniyo hayvana :uhm::roflol:

giznur
8-07-08, 01:07
benim de erkek bi muhabbet kuşum var ..ne yalan söyleyim tek azgın benim muhabbet kuşum zannederdim .:roflol:meğer hepsinde varmış bu durum .
ben buna bebekken aldığımda canı sıkılmasın arada oynasın die kafesinin üstüne küçük bi oyuncak ayı taktım .. zamanla onunla oyun oynamaya başladı sonrada zevcesi yaptı ..valla şimdi bütün gün tepesinde yıkamak için almak istesem bile bana çok kızıyor..Kötü Kazenaşkım aşkııııım die bağırıyo .. ya bunlar ne velet ya gerçekten anlıyomu ne..naniknanik
ama onu çoook seviyoz ya bitanem benim..
işte bizim durumda böle yani bu yönden pek bi sıkıntımız olmadı valla .. kendi kendine çözdü sorununu ..erkek kuşları olanlara tavsiye ederim ..

december canım valla senin yapacan pek bişi yok gibi güzelim ya.. bence onu kuşcuya götür 1 -2 hafta misafir olsun orda ,belki bu dönemi geçicidır..
geçmediğini fırçadan anlarsınız zaten :eek:.. o zaman bi erkek almanızdan başka çare görünmüo gibi...

EU1
8-07-08, 01:07
kuşun ne durumda hala aynımı..?

decemBer
8-07-08, 18:07
kıç sallamayı bıraktı ama evin içinde hayvan deli danalar gibi oldu.
bağırıp çağırıyor durduk yere ciyak ciyak. ötmek değil ama catcatcat diye ayy hele de başkası konuşuyo olsun kaynana gibi oldu dakikalarca susmadan catcatcatcatcatcatcat yapıyo ordan oraya uçuyo. sürekli böyle şikayet eder gibi yırtınıp duruyo. diyom bizimkilere bakın bu "canıma tak etti evden kaçacam" demek diyom annamıyolar. sinir yaptı hayvancağız :KK43:( babama sırnaşıyo gene hala :S

Princess
30-07-08, 10:07
Kızlar ağustos ayında bir haftalık şehir dışına çıkmayı düşünüyoruz.
muhabbet kuşumuza iyi bakabileceğini düşündüğümüz kişiler var,onların da kuşu var.
fakat biz kuşu biraz bebek gibi yetiştirdik.
mesela topları var, toplarını halıya çıkarırız akşama kadar oynar, ya da geceleri benim yatağımın dibine kafesini koyarım, öyle uyuruz.
endişeleniyorum başka birinde bir hafta problemsiz kalabilir mi?
onu götürmem zor çünkü 1 hafta için yollara,sıcağa,ortam değişikliğine dayanması zor olur.

nevbahar
30-07-08, 12:07
Merhaba, elbet ki kimse sizin bakabildiğiniz gibi bakamayacak.

Çok seven biride olsa istesede sizin gibi bakamayacak. Çünkü kuş yabancı bir ortam görecek tanımadığı insanlar olacak. Biraz afallayacak yani.

Siz hayvanları çok seven birine bırakın zaten alışma süreci bitene kadar siz dönmüş olacaksınız.

XGİRLS
31-07-08, 15:07
arkadaşlar bn muhabbet kuşumu değiştirdim 45 günlük erkek isim ne koyayım sizce